parB [2018-02-12T09:55:47.000Z]

chromosome positioning near the pole and transport through the polar septum / antagonist of SMC complex to the origin of replication

locus: BSU40960

pI: 8.42

mw: 32.06 kDa

protein length: 282 aa

gene length: 846 bp

function: chromosome positioning before asymmetric septation

product: centromer-binding protein

essential: no

synonyms: spo0J,spo0JB

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.3|DNA condensation/ segregation]
• [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]

Gene

Coordinates: 4,205,556 → 4,206,404

Phenotypes of a mutant

• a [gene|search|whiA ][gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB] double mutant is not viable, this can be suppressed by inactivation of [gene|search|yneA ][pubmed|29378890]

The protein

Catalyzed reaction/ biological activity

• forms DNA bridging interactions around parS to condense DNA and earmark the bacterial chromosome for segregation [pubmed|29244022]
• inhibits [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] dimerization and concomitant DNA-binding activity by stimulating [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] ATPase activity [Pubmed|21235642]
• recruits the condensin complex to the DNA origin region [Pubmed|24440393]
• the dimer binds specifcally to the centromere-like ''parS'' sequence [Pubmed|25572315]

Protein family

• parB family (according to Swiss-Prot)

Paralogous protein(s)

• [protein|559DEDC9887B811EF80994526256ADC48BA51CE3|Noc]

[SW|Domains]

• N-terminal domain (NTD, aa 1 - 96): binds [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA] [pubmed|10064607]
• Central DNA-binding domain (CDBD, aa 102 - 216): binds parS DNA [pubmed|16306995]
• C-terminal domain (CTD, aa 233 - 282): binding of non-specific DNA, dimerization, essential for DNA condensation [pubmed|29244022]

Structure

• [PDB|4UMK] (complex with ''parS'' DNA)
• [PDB|5U1G] [pubmed|28373206]
• [PDB|5U1J] [pubmed|28373206]

[SW|Localization]

• chromosome centromer [Pubmed|23475963]

Expression and Regulation

Operons

• genes: [gene|5B3DB5A796ACA48390278E60478DFF13D0074A8D|parA]-[gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB]
  description: [Pubmed|22383849]

  regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]

  regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]

Biological materials

Mutant

• 1S135 ( ''spo0J''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S135&Search=1S135 BGSC]
• 1S136 ( ''spo0J''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S136&Search=1S136 BGSC]
• 1S137 ( ''spo0J''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S137&Search=1S137 BGSC]
• BKE40960 (Δ[gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCATTAATCCCTTTTCCAA, downstream forward: _UP4_TAAATGAAAAAACCATCTTT
• BKK40960 (Δ[gene|EF4BD49FCD49EE97908973581478951C8FA196C0|parB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCATTAATCCCTTTTCCAA, downstream forward: _UP4_TAAATGAAAAAACCATCTTT

Labs working on this gene/protein

• [SW|Heath Murray], Centre for Bacterial Cell Biology, Newcastle, UK [http://www.ncl.ac.uk/camb/staff/profile/heath.murray homepage]

References

Reviews

• 22934648,26706151,28075389

Original publications

• 17462018,16677298,12562803,10852876,10482533,9506522,8071208,17932079,21235642,26253537,9663676,11532141,15659156,18854156,9159397,8866474,9778525,16925562,1900505,9364919,9701805,12950914,14651647,19450517,19450516,14563866,23475963,21911367,24440393,24829297,24696501,25071173,25572315,25951515,26295962,28154080,28373206,28407103,29244022,16306995,29378890